| HOME SCHEDULE AUTHOR INDEX SUBJECT INDEX |
|
(266) EXPRESSION OF PERI-ATTACHMENT FACTOR IN OVINE CONCEPTUS AND ADULT TISSUES. Wright, Casey1, Scheaffer, Abraham1, Anthony, Russell1, 1 Colorado State University, Fort Collins, CO ABSTRACT- A novel mRNA transcript was recently described in bovine conceptus tissue, and named Peri-attachment Factor (PAF). Bovine PAF (bPAF) mRNA is present during early conceptus expansion (days 15 and 17 post coitus), but was absent from tissues collected after day 30 and in adult tissues. The exception to this was the detection of bPAF mRNA in the adult kidney. Based on the inferred amino acid sequence of bPAF, it was hypothesized that PAF is a nuclear protein, that may play an active role in early conceptus development. Our objective was to examine sheep conceptus and adult tissues for the existence of a PAF mRNA homologue. Total cellular RNA was collected from day 13 and 15 ovine conceptus and selected adult tissues (heart, lung, liver, spleen, kidney, skeletal muscle and brain), and subjected to Northern hybridization with a random-prime labeled bovine PAF cDNA. Additionally, day 135 ovine fetal heart and liver were screened for PAF mRNA. Verification of the Northern hybridization results was obtained by reverse transcriptase-polymerase chain reaction, using primers derived from the bovine PAF predicted open-reading frame (upper, 5′ atcagcaccccagtctcctc 3′; lower, 5′ ctctcgggctattgcttgtc 3′), yielding a 223-bp product which was subjected to nucleotide sequencing. These analyses demonstrated ovine PAF expression in day 13 and 15 conceptus tissue, coinciding with the stage of conceptus development when bPAF mRNA is present. Analysis of adult sheep tissues detected PAF in kidney and lung. Interestingly, two distinctly different transcript sizes were revealed by northern analysis within adult lung however, RT-PCR analysis yielded only the 223-bp product. Screening of day 135 fetal ovine lung and heart revealed detectable PAF mRNA in the lung but not in the heart. Our results with sheep tissues are similar to those reported for cattle, except that PAF was detected in adult and fetal lung. The appearance of two PAF transcripts in adult lung indicates that the primary PAF transcript may be alternatively-spliced, at least in some tissues. While nothing is known about the function of PAF, it has now been described in two ruminant species, during a critical window of conceptus development. Further characterization of PAF is needed before a role for this protein can be assigned. KEY WORDS: conceptus, peri-attachment factor |
