PARENT SESSION

(M709) REVEALING APOPTOSIS IN SMALL SAMPLES OF DNA.

Campbell, Kenneth¹, Ko, Sung-Hwan¹, ¹ University of Massachusetts, Boston, MA

ABSTRACT- Ovarian cycles are tracked in many species with vaginal smears. A less invasive method uses urine sediments, primarily estrogen-sensitive urethral epithelia, a common index for staging cycles until 1960. Epithelial proliferation and cornification includes apoptotic hydrolysis of DNA which can be followed by appearance of laddered bands at 180-200 bp intervals from about 200-3000 bp on agarose gels loaded with ug samples of DNA. But many samples are <1 ug. Other methods are labor intensive, unsuited for isolated DNA or some labs, or can alter DNA fragment patterns unpredictably. Amplifications reproducing all DNA fragments are preferable preceding visualization of ladders. We adapted a method that ligates unique short tails to DNA and amplifies the tailed fragments with PCR. DNA samples (1 ug) were treated with T4 DNA polymerase (3 U; 50 mM NaCl, 10 mM Tris, 10 mM Mg, 1 mM DTT, 100 ug/mL BSA, 100 uM dNTPs, pH 7.9; 12°C, 15 min) to generate blunt-ended (polished) fragments. The reaction was halted with EDTA (10 mM) and heat (20 min, 75°C). Subsamples of polished DNA (100 ng) were ligated on both DNA strands using T4 ligase (400 U; 50 mM Tris, 10 mM Mg, 1 mM ATP, 10 mM DTT, 25 ug/mL BSA, pH 7.5; 3 h, 25°C) and a double-stranded 30-mer (0.2 uM gggcacggttgcacgacggcccgggctggt) added directly to the polished DNA. After ligase inactivation (10 min, 70°C), DNA (0.3-9 ng) was amplified (1 U Taq, 200 uM dNTPs, 0.6-10 uM primer accagcccgggccgtcgtgcaaccgtgccc, 2 mM Mg, 30 x (1 min, 94°C; 2 min, 70°C) + 1x 10 min 72°C). PCR products were run on 2% agarose gels, stained with ethidium bromide, and inspected visually and photographically. Reproductions of 1 kb sequencing ladders, lambda Hind III digest patterns, and apoptotic ladders from dexamethasone-treated mouse thymus have been obtained. Sequences of >5000 bp were lost in mammalian DNA but the apoptotic ladder region was preserved; sequences to 20,000 bp were reproduced in simple systems under the conditions employed. While we will next apply this method to urine sediment DNA, it is clear it is an alternative to kits and is applicable to many other situations where apoptosis in small DNA samples is of interest.

KEY WORDS: Apoptosis, DNA ladders, Methods